About Enhancer
| Enhancer ID: | E_01_195 | |
| Enhancer symbol: | -- | |
| Species: | Human | |
| Position : | chr1:98517055-98517909   |
|
| Biosample name: | Neuroblastoma Cell Lines | |
| Experiment class : | Low+High throughput |
| Enhancer type: | Enhancer | |
| Disease: | Schizophrenia | |
| DO: | DOID:5419 | |
| Mesh: | D012559 | |
| Distance from TSS: | >2KB | |
| Pubmed ID: | 25434007 |
| Enhancer experiment: | Luciferase Reporter Assay,3C,PCR,EMSA | |
| Enhancer experiment description: | SNP 1:g.98515539A>T is within an ENCODE--annotated neuronal cell (NH--A and SKNSH) specific enhancer and promoter ~3.6 kb upstream of MIR137 (Figure 1A).We hypothesized that the risk allele of 1:g.98515539A>T reduced enhancer activity by interfering with YY1 binding. To test the hypothesis, we cloned the putative enhancer sequence (the transcribed minus strand) flanking 1:g.98515539A>T into a luciferase reporter gene vector (pGL3--promoter) (Figure 2A; Table S6). As expected from the ENCODE functional annotation, the cloned sequence exhibited robust enhancer activity as indicated by luciferase expression in a human neuroblastoma cell line (SH--SY5Y), but not in HeLa cells. |
About Target gene
| Target gene : | MIR137(MIRN137,miR-137) | |
| Strong evidence: | 3C | |
| Less strong evidence: | -- | |
| Target gene experiment description: | SNP 1:g.98515539A>T is within an ENCODE--annotated neuronalcell(NH--Aand SKNSH) specificenhancer and promoter ~3.6 kb upstream of MIR137.We therefore performed the 3C assay 58–60 in SH--SY5Y cells to examine whether the 1:g.98515539A>T site can physically interact with core promoters of DPYD and LOC729987 (Figure 4A). We identified specific physical interaction of the enhancer sequence flanking 1:g.98515539A>T with other putative regulatory sequences upstream of MIR137/MIR2682, but not with the core promoters of DPYD or LOC729987 (Figure 4B). This suggests the functional 1:g.98515539A>T might influence expression of MIR137/MIR2682, but not of DPYD or LOC729987. |
About TF
| TF name : | YY1(DELTA,GADEVS,INO80S,NF-E1,UCRBP,YIN-YANG-1) | |
| TF experiment: | EMSA | |
| TF experiment description: | EMSA for YY1 binding. A doublestranded oligonucleotide (29 bp; on minus strand) flanking the YY1-binding site and 1:g.98515539A>T (allele T or A; AGAGGTGCTGTGAACACACAGCCATTTTC t/a TAGCAGCTTTTTGACTG TATGTTACCATA) was incubated with the nuclear extracts of neuroblastoma (SH-SY5Y) cells. |
About Function
| Enhancer function : | -- |
| Enhancer function experiment: | -- |
| Enhancer function experiment description: |
-- |
About SNP
| SNP ID: | rs1198588 | |
| SNP position: | 98515539 |
| SNP experiment: | Luciferase Reporter Assay,EMSA,3C |
Enhancer associated network
The number on yellow line represents the distance between enhancer and target gene
